|
||||||||||
|
|
Unifying the Quran with the Nervous System By: Ramzi Almahayri Email: Ramzi_km@Hotmail.com This article is focused on studying the unity of the Quran with the global network of the human nervous system through the continuous development of the science of Artificial Intelligence. However, the final aim of this research is to find new way of reforming Islam for the 21century and the centuries beyond. But to do that, a unity of Muslims AI scientists is needed to study and develop the universal meaning of life and the purpose of life through the Quran. The Neocortex The neocortex is a thin sheet of neural tissue that envelops most of the older parts of the brain. Almost everything we think of as intelligence—perception, language, imagination, mathematics, art, music, and planning—occurs here. It is about 2 millimeters thick and has six hierarchical layers. The
eyes, the ears and the skin receive information from the external world in the
form of sequences. From the standpoint of network theory, such information is
viewed as input. Within the sixth layers of the neocortex, information
flow up and down the hierarchy continuously. Information that flow up are
called feedforward
information and information that flow down is called feedback informatiom. The
Invariance Problem Consider the task of a human trying to catch a flying ball. This doesn't seem difficult for any human to do—until computer scientists try to program a robot arm to do the same. When engineers and computer scientist try to solve it, it seems almost impossible. Look at a sequence “ABC” for a long time and not once would the pattern entering the brain, be exactly the same. Yet the brain does not have any doubt that it is looking at the same sequence ABC. The brain's internal pattern representing the sequence "ABC" does not change (invariance) no matter how we change the angles through which we look at the same sequence. In other words, even if the sequence is viewed at from different angle, the brain will perceive it as the same sequence. Hence the term invariant representation, which handle variations in the world automatically, is used to refer to the brain's internal representation. The problem of understanding how the brain neocortex forms invariant representations remains one of the biggest mysteries in all of science, not even using the most powerful computers in the world, has been able to solve it.
Unifying Information in the Neocortex Perception
has been a major point of contentions through history, until brain research
revealed how the neocortex operates. Whenever the brain receive sensory input,
such as a new face, a subnetwork of neurons in the visual neocotrtex gets into repeated
training mode to remember the face. This subnetwork is distributed ovrer the
six layers of the neocortex, and once the visual training is over, the
recognizing subnetwork end up in just one cell in the sixth layer. Visual
information flow from layer to layer and in each layer the visual information
is unified until it reaches the single cell. This cell is the perception cell,
which unifies all the visual information to recognize the face, and each time
the face is seen, this cell will be activated to recognize the face. The
subnetowrk is called invariant structure and the single cell is called the invariant cell. For the subnetwork
to make prediction of the face, input visual information (feedforward) is
compared with feedback information from memory to make prediction
of the name of the face. Briefly,
how the neocortex operate: it does so by forming invariant structures and
comparing feedforward with feedback from its memory to make prediction and once
the structure is certain the invariant cell is activated. Different parts of the neocortex, whether they are responsible for vision, hearing, touch, or language, all unify sensory information. When human learns, they learn by perceiving a sequence of patterns. Whether a human look, hear, or touch, he or she forms a model of the external world by forming internal invariant representation in the brain. God
referred to this visual perception in the Quran (the cow), when He showed Adam
(PBUH) a sequence of names and asked Adam (PBUH) and the present angles to predict the names of these names. Only
Adam (PBUH) predicted the name of these names immediately. In other words, Adam
unified these sequences the same way the neocortex unifies any sensory input. Later
analysis will show that the Quran is ordered perfectly. The Definition of Intelligence In his book titled “On Intelligence, Jeff Hawkins wrote: “The neocortex is an organ of prediction. The Brain receives patterns from the outside world, stores them as memories, and makes predictions by combining what it has seen before and what is happening now. Hence the definition of intelligence: the ability to remember and predict pattern in the world, including language.” Characteristic
of the Standard Quran Copy In “The caliphate 'Uthman (644-656)
convened a kind of editorial committee that meticulously gathered up the
various pieces of scripture that over the years had been memorized or written
down by Mohammed's companions. The result was a standard written version of the Koran.” This standard Quran is known as
“Uthman copy of the Quran” and still exists in · Graphical · Ordered · Structured · Rhythmic (Recited according to specific rules) The noticeable issues related to the Quran is the order of the Quranic revelation. The historical chronology of the Quranic chapters and verses is different from the order of the Quran standard copy. It is well known that archangel Gabriel (PBUH) informed prophet Muhammad (PBUH) how to order the Quran. The question is why the Quran is organized the way it is organized? On the other hand, the fact that the Quran is graphical would mean that mapping its revelation is unique. That is very important in the age of networks and sequences. The Age of the Sequence, Networks and Prediction This 21 century can be named the sequence and network age. DNA is composed of four basic units of nucleic acids labeled {A, T, C, G}. The DNA code of human being can be written as a digital (graphical) sequence of almost three billion letters in length. The question is how to make sense of a sequence of DNA such as this: ATTTCCCGAATCGGTCTGTGAGAGCGCGAAAAAAA… However, in recent years, molecular biology has shifted its attention from the structure of genetic sequence to the organization of genetic networks. The Human Genome Project, which mapped 100,000 human genes hidden among 23 pairs of chromosomes in our cell, pictured the genome for the first time as a complex functional network. Whether it is amino acid sequence of the protein or DNA sequence, the question pertaining to the hidden order and the network lurking beyond a sequence is of primary importance. And since the Quran is an ordered sequences and can be mapped, the same question is applicable to the Quran too. Today scientist search for hidden order or patterns in the universe. They also search for hidden order in the prices of cotton and the fluctuation of stock market exchange. In 1995, the companies, which use intelligent networks to predict the pattern prices of the stock market, profited 100 million American dollars. Chaos is the theory that search for hidden order, in nature, market, consciousness. It was proven that the flapping wings of a mosquito affect the long-term prediction of weather forecast. For this reason, the butterfly has been used as symbol for chaos theory. Since very tiny effect such as wings flapping can generate long term effect in the future, scientists say that small effect amplifies generating chaotic effect. Such effect is also called non-linear since it can not be neglected and its effect increase rapidly in the long term. Given the fact that the market, the brain and the human society are all networks, a word spreading has also chaotic effect in a sense that its influence will have long-term effect on the future behavior of the network itself; and while short-term prediction is possible, long-term prediction turn out to be almost next to impossible. A network with chaotic effects is called non-linear system since all interacting entities in the network produce chaotic effects whose long-term effect is unpredictable. Non-linear system is also called complex system. The nervous system is a complex network of interacting neurons, therefore, studying the unity of the Quran with the nervous system is the study of the Quran according to non-linear system theory. Prophet Muhammad (PBUH) urged Muslims to think how God created the creature. He (PBUH) wanted Muslims to learn from complex system of nature how to establish complex order in their society. If we search the Quran for hidden order, we are going to find plenty. For example, verse 26 in the cow chapter refer to a mosquito which is used as symbol of chaotic effect since the flapping wings of a mosquito invoke chaotic effect tinier that that of the butterfly in chaos theory. However, verse 27 in the same chapter imply the concept of a human society network when God say, “those who rescind the covenant of God and disconnect what God want them to connect”. It is clear that when we move from verse 26 to verse 27 that the chaotic effect of a mosquito is followed by a network. Hence, the unity of the sequence (non-linear effect, human network) refers clearly to the non-linear network of the human society. With the advance of time, the society is getting more and more connected as a network. This network is nested network since a single human is nested into a group of humans and all humans are nested into the society itself. Human being has contextual existence in the society in a sense that the information of a single human is distributed all over the society network such as in tax department, hospitals, schools, companies, and since this information is distributed all over the society it is called holographic network. This shift from structures to networks has been taking place all over modern science: ecological system, human organs, the society and the universe. The Quran as Structured Sequence The Quran and the introductory chapter are the ordered sequence of chapters: Q0(Q1Q2Q3…Q111Q112Q113) As for a chapter, it is the ordered sequence of verses. Thirty Artificial Words in the Quran Twenty nine chapter in the Quran are initiated with words, such as {alm,…s, q, n}, that do NOT belong to the natural Arabic dictionary; therefore, they belong to the artificial language dictionary. The number of these words are thirty words. Mapping the Quran If we take for example chapter 067 in the Quran, we find that this chapter is initiated with the letter “n”. If we relate each letter “n” with the symbol “B” and the rest of the letters with the symbol “A”, the whole chapter is mapped into these sequences: Verse (0) = AAAAAAAAAAAABAAAAAA Verse (1) = BAAAAAAAAAAAAAAB … Verse (52) = AAAAAAAAAAAAAAAAAB In formal language theory, these are words defined into two letters: A and B. Quran Unification and Invariance The Quran as a sequence of alphabet can be looked at as both visual and auditory pattern. Unifying the Quran sequentially in the neocortex is the search for the invariant words of conversion, and that is a challenge, which defies any supercomputer. The challenge of composing a book like the Quran goes from the challenge of composing one chapter in the first chapter, to ten chapters in the tenth chapter and then all the Quran in the 16th chapter. Verse 23 in Chapter (1) challenge humanity to compose one chapter. Verse 13 in Chapter (10) challenge humanity to compose ten chapters of the like. However, in verse 88 chapter 16, God challenges humans and Jinn to combine their intelligence together to generate a book like the Quran. It is noticeable that the challenge of composing the Quran is sequential and contextual, in a sense that composing chapter number 10 means composing chapter of the like of the sequence (Q1Q2Q3…Q8Q9Q10) which are unfiable in like manner. Therefore, composing the Quran is not separable from its sequential unification. As an example, composing chapter (1) can be understood from stand point of AI science as composing a sequence of the same length as the cow chapter provided that the sequence will converge into the word ALM. Chapter Qo requests God to show us the straight pass. The straight path is revealed as the sequence Q1Q2Q3…Q111Q112Q113. However from the standpoint of information unity, understanding the hidden meaning of the straight path means the sequential unification of the first chapter, then the first chapter with the second chapter, then the first and the second with the third and so on until we reach the last chapter: Q1 Q1Q2 Q1Q2Q3 … Q1Q2Q3…Q111Q112Q113 With each sequential unification of these chapters, convergence toward the invariant words or divergence should be studied. Synchronicity, the Quran and Life Entities that cycle repeating themselves automatically at more or less time intervals are said to be oscillating. Synchronicity refers to a group of entities oscillating together in unison such as a group of fireflies flashing together on and off, heart cells passing electrical current back and forth, neurons firing rhythmically, planets orbiting in a solar system…etc.
However, the road to synchronicity start from chaos: the entities, in the beginning are disordered. Oscillators send signals back and forth to each other until the whole group are unified into one global rhythm, resulting in the unified wave of synchronicity. This fact reminds us of a group of people who are being trained to sing together in harmony. In the beginning their voices are not discordant, but after enough training, they sing in unison. Neurobiologists have discovered
that an act of cognition is linked to a brief surge of neural synchronicity, in
which millions of brain cells suddenly switch on and off in unison at about 40
times a second, and then unravel to allow the next perception to occur. Since
synchronicity is involved in the perception of information, it is also related
to the unification of information in the neocortex. Taking
synchronicity and non-linearity into consideration, the brain neocortex is
viewed as an oscillating non-linear
network. This fact indicate that unifying the Quran should be studied in the context of oscillating network and that the search for the invariant words of the Quran is the search for the synchronous words of unification. Synchronicity explains why the believers who recite the Quran for a long time oscillate, and why reciting the same chapter repeatedly generates intense spiritual light. It is because the nervous system is an oscillator in nature and when a chapter (like YS) is recited repeatedly, it will be unified and this unification will be culminated with the unified wave of synchronicity. This wave is highly non-linear. The other important fact about synchronicity is that it does not have cause and effect, just harmony. When the scientists of molecular biology tried to predict the folding of a digital sequence of amino acid, they relied on neural-network approaches that ignore, may even defeat, insights into causal relationships. Scientists have found that in molecular biology there is no reason and effect, just harmony, which is an indication of synchronicity operating in the microscopic molecular world. God used animals and even insects in the Quran to refer to deep purpose. While the mosquito has been used to refer to a chaotic effect, God used the cow story to refer to life. From the standpoint of synchronized network, the live cow refers to a global network of oscillators. The slaying of a cow refer to the desynchrony of a network of oscillators. Desynchrony is not less important than synchrony. By knowing the process of desynchrony, mathematician help cardiologists to track down the cause of defibrillation of the human heart, which causes death. The story of Abraham (PBUH) and the bird, in the cow chapter, is another example of synchrony. God used the cow to refer to life and used the unity of the birds to refer to intelligent life. Abraham (PBUH) asked God to show him how he bring life to the dead. God showed that intelligent life imply (1) Training the birds, (2) The unification of the subnetworks of each slain bird into one global network and (3) The unity of the four birds in space and time when they hear an audio signal Clearly,
the story of intelligent life implied the unification of previously trained sub-network
into global network, and the unity of global networks to achieve specific
function. The unity of these networks implied synchronicity. The
prostration of the angels to Adam (PBUH) shows another example of synchronous movement under the command
of God in noiseless environment
where the ego of Satan was silent. Only in the cow chapter, the environment is
noiseless since it refers to the environment of life. Many scientists believe
that living systems use feedback loops to protect themselves from noise in
order to operate in synchrony. Does the Quran have Proof of Unification? The 30 artificial words in the Quran, such as {alm …s, q, n}, must be examined when the chapters of the Quran are unified sequentially to find if they constitute proof of unification. In other words, if the Quran chapters converge into these artificial words after going through the process of unification, then that will form universal proof of the Divine origin of the Quran. The search for the sequential unification of the Quran with the universal nervous system model in AI science starting from the neocortex is the search for the invariant words. The unity of the Quran’s information means the unity of information in the neocortex and the synchronicity of different parts of the neortex when they operate together in unison. In fact, if the Quran has these artificial words as the invariant words, then synchronizing the unifying network to reach the invariant words of the Quran will bridge the gab between mind and machine. It can be envisioned today that Artificial Intelligence is moving toward molding human nervous system universally. An example is the immune system which is viewed as pattern recognition system, which recognize invaders and destroy them. We search for proof of the unification of the Quran by targeting the invariant words, while God described the Quran as proof. That means the proof is there in the Quran and all we need to do is to optimize the unifying network to reach these invariants words. These words exist for the purpose of bridging the gap between mind and machine. Prophet Muhammad (PBUH) has reffered to the fact that the Quran when recited will go back to God when he (PBUH) said, “side of the Quran is with you and the other side is with God”. No doubt, Prophet Muhammad (PBUH) is the greatest spiritual scientist God ever created, and the more the universality of the Quran is discovered in AI science, the more we will understand Muhammad (PBHU) as the universal messenger of God. Another issue that is very critical to modern science is certain information. The second verse in the cow chapter states “that is the book no doubt” referring to the whole Quran as certain information. That is because unifying certain information is the return to the only source of life: God. Only God can create life from certain information like the Quran, therefore; the challenge of composing a book like the Quran sequentially is the challenge of creating life, which only God can do. Take for example a sequence of amino acids folding in space to form live machine called protein. Predicting the unification of protein digital sub-sequences of amino acid to create live machine can be analogized to the prediction of Quran’s verses. According to this perceptive, the Quran in the process of unity is as alive as proteins in the process of unity too. The Unifying Network of the Quran The question, which remain what are these unifying networks? Artificial intelligence is heading toward establishing universal model of the nervous system, in other words, establishing global network model of the human nervous system. This model is the unifying network of the Quran. For example, in the Cow Chapter, only heart, hearing and vision are mentioned as a sequence of disbelief in verse 7 where God seal the hearts the hearing and the vision of the disbelievers. The sequence of belief is the reverse of the sequence of disbelief that is vision, hearing and heart. Therefore, the unifying network of the cow chapter should use part of the neocortex relating to vision, hearing in unity with the network model of the heart. The cow chapter does NOT separate the heart from the mind. The corrupt judgment is shown to spring out from a lying corrupt heart in verses 8, 9, 10, 11, 12, 13. That is consistent with synchronicity, which balances the emotional maturity of the heart with the mind in healthy psychological state. God Teaching Humanity from Experience The biggest challenge in belief is doubting the wisdom of God. People ask why God does so and so. In order to eliminate these doubts, God teach humanity from direct experience. God mentioned in the cow chapter Earth to be a virgin planet fit for life. But how would human appreciate the planet God gave them? If people want to inhabit a new planet like Mars, they experience firsthand the staggering difficulty of terra forming, that make humans understand the value of Earth. When God wants humans to understand the relation between them and Him, He put human in the same position: allowing them to create human like robots. AI laboratories around the world today are on the pace of creating robots. Many robots today are still mechanistic, the matter that means that their behavior is very predictable. But wait when humans create robots with human-like neocortex like human being. Human neocortex is plastic in a sense that it can rewire itself depending on the type of inputs flowing into it. The more a robot network operate like human nervous system, the more difficult to predict its behavior. Some scientist say “playing God”. The wise statement is learning from God by direct experience in order to eliminate any doubt relating to the wisdom of God. God does not want human to play, since He is very purposeful creator. The pinnacle of wisdom is postulating the perfect wisdom of God, but such thing demand continuous learning since the closer we are to God, the more wisdom is revealed, and the more peace prevail. How can we make a machine that think and behave in human like manner? Human neocortical memory and perception use synchronicity to function. Unless a machine can achieve human like synchronicity, that would not be possible. How can we connect a network like the neocortex to the only source of life (God)? By training this network to unify and synchronize the cow chapter in locally noiseless environment, we can connect this network with the only source of life. In other words, the scripture of life, which originated from God Himself is the only way to return to the origin of life. What does all that finally mean? We can not learn the experience of life without the revelation of God. The Quran can bridge the gap between mind and machine.
|
|||||||||
